IRJET- Implementation of DNA Cryptography in Cloud Computing and using Socket Programming
0 likes48 views
This document discusses implementing DNA cryptography in cloud computing using socket programming. It begins with an abstract that introduces DNA encryption as a technique to strengthen data security on cloud computing by addressing issues when data resides on cloud service providers' servers. It then provides background on cloud computing and discusses previous work on improving cloud data security through techniques like Diffie-Hellman key exchange and AES encryption. The proposed work focuses on enhancing an existing bi-directional DNA encryption algorithm to support non-English Unicode characters using DNA digital coding, key combinations, and socket programming for encryption and decryption of data stored in the cloud.
![International Research Journal of Engineering and Technology (IRJET) e-ISSN: 2395-0056
Volume: 06 Issue: 03 | Mar 2019 www.irjet.net p-ISSN: 2395-0072
© 2019, IRJET | Impact Factor value: 7.211 | ISO 9001:2008 Certified Journal | Page 578
IMPLEMENTATION OF DNA CRYPTOGRAPHY IN CLOUD COMPUTING
AND USING SOCKET PROGRAMMING
Y SOWJANYA1, Dr P VENKATESWARA RAO2
1Student, Dept. of Computer Engineering, Adikavi Nannaya University, Rajamahendravaram.
2Associate Professor, Dept. of Computer Engineering, Adikavi Nannaya University, Rajamahendravaram
---------------------------------------------------------------------***----------------------------------------------------------------------
Abstract - Cloud computing is the latest technology in the
field of distributed computing. It provides various online and
on-demand services for data storage, network services,
platform services and etc. Many organizations are
unenthusiastic to use cloud services due to datasecurityissues
as the data resides on the cloud services provider’s servers. To
address this issue, there have been several approachesapplied
by various researchers worldwide tostrengthensecurityof the
stored data on cloud computing. The Bi-directional DNA
Encryption Algorithm (BDEA) is one such data security
techniques. However, the existing technique focuses only on
the ASCII character set, ignoring the non-English user of the
cloud computing. Thus, this proposed work focuses on
enhancing the BDEA to use with the Unicode characters
Key Words: Cloud computing, Data security issues, Bi-
Directional DNAEncryptionAlgorithm, DNAdigitalcode,
Socket Programming.
1. INTRODUCTION
Cloud computing has recently reached popularity and
developed into a major trend in IT. We perform such a
systematic review of cloud computing and explain the
technical challenges facing in this paper. In Public cloud the
“Pay per use” model is used. In private cloud, the computing
service is distributed for a single society.InHybridcloud, the
computing services is consumed both the private cloud
service and public cloud service. Cloud computing has three
types of services. Software as a Service (SaaS), in which
customer prepared one service and run on a single cloud,
then multiple consumer can access this service as per on
demand. Platform as a Service (PaaS), in which, it provides
the platform to create application and maintains the
application. Infrastructure as a Service (IaaS), as per term
suggest to provides the data storage, Network capacity, rent
storage, Data centers etc. It is also known as Hardware as a
Service (HaaS).
2. Literature Survey
In cloud computing the major issue is to provide the security
of data. In Cloud computing data security is prepared by the
Authentication, Encryption & Decryption, Message
authentication code, Hash function,andDigitalsignatureand
so on. So here we discuss about some security problems and
their solutions.
Use of Digital Signature with Diffie Hellman Key
Exchange and AESEncryptionAlgorithmtoEnhanceData
Security in Cloud Computing [1].
Mr.PrashantRewagad and Ms.YogitaPawar [1]. Here in this
paper, theresearcherusingthreewayarchitectureprotection
schemes. Firstly Diffie-Hellman algorithm isusedtogenerate
keys for key exchange step. Then digital signature is used for
authentication, thereafter AES encryption algorithm is used
to encrypt or decrypt user’s data file. Diffie- Hellman key
exchange algorithm is vulnerable to main in the middle
attack. The most serious limitation is the lack of the
authentication.
Union of RSA algorithm, Digital Signature and Kerberos
in Cloud Security [2].
Mehdi Hojabri and Mona Heidari [2]. Here in this paper, the
researcher first performs the concept of Kerberos
authentication services. At the next step the Authenticate
Server (AS) of Kerberos do verifies users and created the
ticket granting ticket and session keyanditsenttotheusers.
The next step users send the ticket granting ticket and
session key to Ticket Granting Server (TGS) for getting the
service. Then TGS send ticket and session key for user. In
final step the users send the request service to cloud service
provider for using the cloud service and also cloud service,
provide service to users. After doing this step user can used
the cloud service provider. But for more security they
performed RSA algorithm for encryption & decryption and
then they use Digital Signature for Authentication.
Implementation Digital signature with RSA Encryption
algorithm to enhancethe DatasecurityofcloudinCloud
Computing [3].
Uma Somani, Kanika Lakhani, and Manish Mundra [3]. In
this paper, there are two enterprises A and B. An enterprise
A has some data that are public data and enterprise has
public cloud. Now B wants some secure data fromA’scloud.
So RSA algorithm and Digital signature are used for secure
communication. In this method, enterprise A takes data
from cloud, which B wants. Now the data or document is
crushed into little line using Hash code function that is
called Message digest. Then A encrypts the message digest
within private key the result is in the Digital signatureform.
Using RSA algorithm, A will encrypt the digital signed
signature with B’s public key and B will decrypt the cipher](https://image.slidesharecdn.com/irjet-v6i3109-190812060322/85/IRJET-Implementation-of-DNA-Cryptography-in-Cloud-Computing-and-using-Socket-Programming-1-320.jpg)
![International Research Journal of Engineering and Technology (IRJET) e-ISSN: 2395-0056
Volume: 06 Issue: 03 | Mar 2019 www.irjet.net p-ISSN: 2395-0072
© 2019, IRJET | Impact Factor value: 7.211 | ISO 9001:2008 Certified Journal | Page 579
text to plain text with his private key and A’s public key for
verification of signature.
3. PROPOSED SYSTEM
Previous section describes the study about the cloud
computing, basics of cloud computingandsecurityproblems
occurs in cloud. Then study some papers to solve these
security problems. Here in this paper, the Bi-serial DNA
encryption algorithm is performing, that providing the two
level of security.
DNA DIGITAL CODING
In information science, the binary digital coding encoded by
two state 0 or 1 and a combination of 0 and 1. But DNA
digital coding can be encoded by four kind of base as shown
in table 1. That is ADENINE (A) and THYMINE (T) or
CYTOSINE (C) and GUANINE (G). There are possibly 4! =24
pattern by encoding format like (0123/ATGC) [4].
Table 1. DNA Digital Coding
Binary value DNA digital coding
00 A
01 T
10 G
11 C
KEY COMBINATION
Here in this work, we are using ATGC as a key. Everybithave
2 bits like A=00, T=01, G=10, and C=11 and by using ATGC,
key combinations is generated and give numbering
respectively that is given into table. From the table 2, wecan
generate 64 bit key values and adding ATGC, we can
generate 72-bit key (64 bits of key combination and 8 bits of
ATGC). ATGC key is sending to the receiver side by using
Diffie Hellman key sharing algorithm. In this work, every
time the key value will be randomly changed.
Table 2: Key combination
KEY
COMBINATION
PATTERNS VALUES
AA 0101 5
AT 0011 3
AG 0001 1
AC 0010 2
TA 0110 6
TT 1111 15
TG 0111 7
TC 1001 9
GA 1010 10
GT 0100 4
GG 1000 8
GC 1100 12
CA 1110 14
CT 1011 11
CG 0000 0
CC 1101 13
A. ENCRYPTION PROCESS
Fig 1: Encryption process
To understand the scenario of proposed work flow chart we
consider one example. In this the example plaintext is
“Hello Technocrete” and performing encryption operation.
Plaintext:
Hello Technocrete
Unicode:
આશિષ](https://image.slidesharecdn.com/irjet-v6i3109-190812060322/85/IRJET-Implementation-of-DNA-Cryptography-in-Cloud-Computing-and-using-Socket-Programming-2-320.jpg)
![International Research Journal of Engineering and Technology (IRJET) e-ISSN: 2395-0056
Volume: 06 Issue: 03 | Mar 2019 www.irjet.net p-ISSN: 2395-0072
© 2019, IRJET | Impact Factor value: 7.211 | ISO 9001:2008 Certified Journal | Page 582
WORKING ON AMAZON WEB SERVICE.
.
Fig.8: Encryption in AWS
Fig.8: Encryption in AWS
Fig.9: Decryption in AWS
3. CONCLUSION
Data security is the main challenge for cloud usability.
Various algorithms like RSA, Diffie-Hellman,DNAencryption
etc. are available to provide data security for the data stored
on cloud. Digital signatures, Extensible Authentication
Protocols are used for authentications. Using BDEA
algorithm, we achieve 2-layer security for ASCII character
sets. The proposed system focuses on extending the BDEA
algorithm to be used with Unicode character set. This can
help reach to the wider community of the cloud users. The
future work will focus on the possible attacks and
cryptanalysis of the cipher text and measure its strength.
REFERENCES
[1] PrashantRewagad, YogitaPawar, “Use of Digital
Signature with Diffie-Hellman Key Exchange and
AES Encryption Algorithm to EnhanceData Security
in Cloud Computing”2013International Conference
on Communication System and Network
Technologies (IEEE Computer Society).
[2] Uma Somani, Kanika Lakhani, ManishaMundra,
”Implementing Digital Signature with RSA
Encryption Algorithm to Enhance the Data Security
of Cloud in Cloud Computing”-2010 IEEE 1st
International Conference on Parallel, Distributed
and Grid Computing (PDGC-2010).
[3] Mehdi Hojabri & Mona Heidari “Union of RSA
algorithm, Digital Signature and KERBEROS in
Cloud Computing” International Conference on
Software Technology and Computer Engineering
(STACE-2012).
[4] Ashish Prajapati, Amit Rathod “Enhancing security
in cloud computing using Bi-Directional DNA
Encryption Algorithm”,International Conferenceon
Intelligent Computing, Communication & Devices.
(ICCD-2014), Springer.](https://image.slidesharecdn.com/irjet-v6i3109-190812060322/85/IRJET-Implementation-of-DNA-Cryptography-in-Cloud-Computing-and-using-Socket-Programming-5-320.jpg)
IRJET- Implementation of DNA Cryptography in Cloud Computing and using Socket Programming
- 1. International Research Journal of Engineering and Technology (IRJET) e-ISSN: 2395-0056 Volume: 06 Issue: 03 | Mar 2019 www.irjet.net p-ISSN: 2395-0072 © 2019, IRJET | Impact Factor value: 7.211 | ISO 9001:2008 Certified Journal | Page 578 IMPLEMENTATION OF DNA CRYPTOGRAPHY IN CLOUD COMPUTING AND USING SOCKET PROGRAMMING Y SOWJANYA1, Dr P VENKATESWARA RAO2 1Student, Dept. of Computer Engineering, Adikavi Nannaya University, Rajamahendravaram. 2Associate Professor, Dept. of Computer Engineering, Adikavi Nannaya University, Rajamahendravaram ---------------------------------------------------------------------***---------------------------------------------------------------------- Abstract - Cloud computing is the latest technology in the field of distributed computing. It provides various online and on-demand services for data storage, network services, platform services and etc. Many organizations are unenthusiastic to use cloud services due to datasecurityissues as the data resides on the cloud services provider’s servers. To address this issue, there have been several approachesapplied by various researchers worldwide tostrengthensecurityof the stored data on cloud computing. The Bi-directional DNA Encryption Algorithm (BDEA) is one such data security techniques. However, the existing technique focuses only on the ASCII character set, ignoring the non-English user of the cloud computing. Thus, this proposed work focuses on enhancing the BDEA to use with the Unicode characters Key Words: Cloud computing, Data security issues, Bi- Directional DNAEncryptionAlgorithm, DNAdigitalcode, Socket Programming. 1. INTRODUCTION Cloud computing has recently reached popularity and developed into a major trend in IT. We perform such a systematic review of cloud computing and explain the technical challenges facing in this paper. In Public cloud the “Pay per use” model is used. In private cloud, the computing service is distributed for a single society.InHybridcloud, the computing services is consumed both the private cloud service and public cloud service. Cloud computing has three types of services. Software as a Service (SaaS), in which customer prepared one service and run on a single cloud, then multiple consumer can access this service as per on demand. Platform as a Service (PaaS), in which, it provides the platform to create application and maintains the application. Infrastructure as a Service (IaaS), as per term suggest to provides the data storage, Network capacity, rent storage, Data centers etc. It is also known as Hardware as a Service (HaaS). 2. Literature Survey In cloud computing the major issue is to provide the security of data. In Cloud computing data security is prepared by the Authentication, Encryption & Decryption, Message authentication code, Hash function,andDigitalsignatureand so on. So here we discuss about some security problems and their solutions. Use of Digital Signature with Diffie Hellman Key Exchange and AESEncryptionAlgorithmtoEnhanceData Security in Cloud Computing [1]. Mr.PrashantRewagad and Ms.YogitaPawar [1]. Here in this paper, theresearcherusingthreewayarchitectureprotection schemes. Firstly Diffie-Hellman algorithm isusedtogenerate keys for key exchange step. Then digital signature is used for authentication, thereafter AES encryption algorithm is used to encrypt or decrypt user’s data file. Diffie- Hellman key exchange algorithm is vulnerable to main in the middle attack. The most serious limitation is the lack of the authentication. Union of RSA algorithm, Digital Signature and Kerberos in Cloud Security [2]. Mehdi Hojabri and Mona Heidari [2]. Here in this paper, the researcher first performs the concept of Kerberos authentication services. At the next step the Authenticate Server (AS) of Kerberos do verifies users and created the ticket granting ticket and session keyanditsenttotheusers. The next step users send the ticket granting ticket and session key to Ticket Granting Server (TGS) for getting the service. Then TGS send ticket and session key for user. In final step the users send the request service to cloud service provider for using the cloud service and also cloud service, provide service to users. After doing this step user can used the cloud service provider. But for more security they performed RSA algorithm for encryption & decryption and then they use Digital Signature for Authentication. Implementation Digital signature with RSA Encryption algorithm to enhancethe DatasecurityofcloudinCloud Computing [3]. Uma Somani, Kanika Lakhani, and Manish Mundra [3]. In this paper, there are two enterprises A and B. An enterprise A has some data that are public data and enterprise has public cloud. Now B wants some secure data fromA’scloud. So RSA algorithm and Digital signature are used for secure communication. In this method, enterprise A takes data from cloud, which B wants. Now the data or document is crushed into little line using Hash code function that is called Message digest. Then A encrypts the message digest within private key the result is in the Digital signatureform. Using RSA algorithm, A will encrypt the digital signed signature with B’s public key and B will decrypt the cipher
- 2. International Research Journal of Engineering and Technology (IRJET) e-ISSN: 2395-0056 Volume: 06 Issue: 03 | Mar 2019 www.irjet.net p-ISSN: 2395-0072 © 2019, IRJET | Impact Factor value: 7.211 | ISO 9001:2008 Certified Journal | Page 579 text to plain text with his private key and A’s public key for verification of signature. 3. PROPOSED SYSTEM Previous section describes the study about the cloud computing, basics of cloud computingandsecurityproblems occurs in cloud. Then study some papers to solve these security problems. Here in this paper, the Bi-serial DNA encryption algorithm is performing, that providing the two level of security. DNA DIGITAL CODING In information science, the binary digital coding encoded by two state 0 or 1 and a combination of 0 and 1. But DNA digital coding can be encoded by four kind of base as shown in table 1. That is ADENINE (A) and THYMINE (T) or CYTOSINE (C) and GUANINE (G). There are possibly 4! =24 pattern by encoding format like (0123/ATGC) [4]. Table 1. DNA Digital Coding Binary value DNA digital coding 00 A 01 T 10 G 11 C KEY COMBINATION Here in this work, we are using ATGC as a key. Everybithave 2 bits like A=00, T=01, G=10, and C=11 and by using ATGC, key combinations is generated and give numbering respectively that is given into table. From the table 2, wecan generate 64 bit key values and adding ATGC, we can generate 72-bit key (64 bits of key combination and 8 bits of ATGC). ATGC key is sending to the receiver side by using Diffie Hellman key sharing algorithm. In this work, every time the key value will be randomly changed. Table 2: Key combination KEY COMBINATION PATTERNS VALUES AA 0101 5 AT 0011 3 AG 0001 1 AC 0010 2 TA 0110 6 TT 1111 15 TG 0111 7 TC 1001 9 GA 1010 10 GT 0100 4 GG 1000 8 GC 1100 12 CA 1110 14 CT 1011 11 CG 0000 0 CC 1101 13 A. ENCRYPTION PROCESS Fig 1: Encryption process To understand the scenario of proposed work flow chart we consider one example. In this the example plaintext is “Hello Technocrete” and performing encryption operation. Plaintext: Hello Technocrete Unicode: આશિષ
- 3. International Research Journal of Engineering and Technology (IRJET) e-ISSN: 2395-0056 Volume: 06 Issue: 03 | Mar 2019 www.irjet.net p-ISSN: 2395-0072 © 2019, IRJET | Impact Factor value: 7.211 | ISO 9001:2008 Certified Journal | Page 580 ASCII: u0e0u0aau02020u0e0u0aau0b6u0e0u0aau0bf u0e0u0a au0b7 Hexadecimal value: 5c753065305c753061615c7530323032305c753065305c 753061615c753062365c753065305c753061615c753062 665c753065305c753061615c7530623 Binary value: 01011100011101010011000001100101001100000101110 00111010100110000011000010110000101011100011101 01001100000011001000110000001100100011000001011 10001110101001100000110010100110000010111000111 01010011000001100001011000010101110001110101001 10000011000100011011001011100011101010011000001 10010100110000010111000111010100110000011000010 11000010101110001110101001100000110001001100110 01011100011101010011000001100101001100000101110 00111010100110000011000010110000101011100011101 01001100000110001000110111 DNA Digital coding: From Table 1 we can write TTCATCTTACAATGTTACAATTCATCTTACAATGATT GATTTCATCTTACAAACAGACAAACAGACAATTCATCTTACAA TGTTACAATTCATCTTACAATGATTGATTTCATCTTACAATGA GACTGTTCATCTTACAATGTTACAATTCATCTTACAATGATTG ATTTCATCTTACAATGAGTGTGTTCATCTTACAATGTTACAAT TCATCTTACAATGATTGATTTCATCTTACAATGAGACTC Now from table 2, the amplified message is generated, Amplified Message 11111110100111110010010101111111001001011111111 01001111100100101011100110111001111111010011111 00100101001100010010010100100001001001011111111 10100111110010010101111111001001011111111010011 11100100101011100110111001111111110100111110010 01010111000100100111111111101001111100100101011 11111001001011111110100111110010010101110011011 10011111111010011111001001010111000101110111111 11110100111110010010101111111001001011111111010 01111100100101011100110111001111111110100111110 0100101011100010010100 B. DECRYPTION PROCESS Now at receiver side, the receiver receives the amplified message and ATGC key for decryption. Fig: 2: Decryption process Amplified Message 11111110100111110010010101111111001001011111111 01001111100100101011100110111001111111101001111 10010010100110001001001010010000100100101111111 11010011111001001010111111100100101111111101001 11110010010101110011011100111111111010011111001 00100111000100100111111111101001111100100101011 11111001001011111111010011111001001011110011011 10011111111101001111100100101011100010111011111 11111010011111001001010111111100100101111111101 00111110010010101100110111001111111110100111110 01001010111000100101001 Now using ATGC key and key combination, retrieve original DNA Digital code. TTCATCTTACAATGTTACAATTCATCTTACAATGATT GATTTCATCTTACAAACAGACAAACAGACAATTCAT CTTACAATGTTACAATTCATCTTACAATGATTGATTT CATCTTACAATGAGACTGTTCATCTTACAATGTTACA ATTCATCTTACAATGATTGATTTCATCTTACAATGAG
- 4. International Research Journal of Engineering and Technology (IRJET) e-ISSN: 2395-0056 Volume: 06 Issue: 03 | Mar 2019 www.irjet.net p-ISSN: 2395-0072 © 2019, IRJET | Impact Factor value: 7.211 | ISO 9001:2008 Certified Journal | Page 581 TGTGTTCATCTTACAATGTTACAATTCATCTTACAAT GATTGATTTCATCTTACAATGAGACTC From the table of DNA digital coding we can generate. 01011100011101010011000001100101001100000101100 01110101001100000110000101100001010111000111010 10011000000110010001100000011001000110000010111 00011101010011000001100101001100000101110001110 10100110000011000010110000101011100011101010011 00000110001000110110010111000111010100110000011 00101001100000101110001110101001100000110000101 10000101011100011101010011000001100010011001100 10111000111010100110000011001010011000001011100 01110101001100000110000101100001010111000111010 1001100000110001000110111 Hexadecimal value: 5c753065305c753061615c7530323032305c753065305c75 3061615c753062365c753065305c753061615c753062665c 753065305c753061615c75306237 ASCII: u0e0u0aau02020u0e0u0aau0b6u0e0u0aau0bfu 0e0u0a au0b7 Unicode: આશિષ Plaintext: Hello Technocrat 4. SNAPS OF PROPOSED WORK (ENCRYPTION). Fig. 3: Encryption operation Fig.4: Encryption flow 5. SNAPS OF PROPOSED WORK (DECRYPTION). Fig.5: Decryption Process Fig.6: Decryption flow
- 5. International Research Journal of Engineering and Technology (IRJET) e-ISSN: 2395-0056 Volume: 06 Issue: 03 | Mar 2019 www.irjet.net p-ISSN: 2395-0072 © 2019, IRJET | Impact Factor value: 7.211 | ISO 9001:2008 Certified Journal | Page 582 WORKING ON AMAZON WEB SERVICE. . Fig.8: Encryption in AWS Fig.8: Encryption in AWS Fig.9: Decryption in AWS 3. CONCLUSION Data security is the main challenge for cloud usability. Various algorithms like RSA, Diffie-Hellman,DNAencryption etc. are available to provide data security for the data stored on cloud. Digital signatures, Extensible Authentication Protocols are used for authentications. Using BDEA algorithm, we achieve 2-layer security for ASCII character sets. The proposed system focuses on extending the BDEA algorithm to be used with Unicode character set. This can help reach to the wider community of the cloud users. The future work will focus on the possible attacks and cryptanalysis of the cipher text and measure its strength. REFERENCES [1] PrashantRewagad, YogitaPawar, “Use of Digital Signature with Diffie-Hellman Key Exchange and AES Encryption Algorithm to EnhanceData Security in Cloud Computing”2013International Conference on Communication System and Network Technologies (IEEE Computer Society). [2] Uma Somani, Kanika Lakhani, ManishaMundra, ”Implementing Digital Signature with RSA Encryption Algorithm to Enhance the Data Security of Cloud in Cloud Computing”-2010 IEEE 1st International Conference on Parallel, Distributed and Grid Computing (PDGC-2010). [3] Mehdi Hojabri & Mona Heidari “Union of RSA algorithm, Digital Signature and KERBEROS in Cloud Computing” International Conference on Software Technology and Computer Engineering (STACE-2012). [4] Ashish Prajapati, Amit Rathod “Enhancing security in cloud computing using Bi-Directional DNA Encryption Algorithm”,International Conferenceon Intelligent Computing, Communication & Devices. (ICCD-2014), Springer.